Nikolai B. Ulyanov

University of California, San Francisco — United States

Biochemistry, Genetics and Molecular Biology · Life Sciences

21h-index1.9kcitations56works0.02yr avg
OpenAlex↗Google Scholar↗Lab page↗

Accepting Students?

No reports yet. Know if this professor is taking students?

Research Topics

RNA and protein synthesis mechanisms(35), DNA and Nucleic Acid Chemistry(23), RNA modifications and cancer(8), RNA Research and Splicing(7), Bacteriophages and microbial interactions(7)

Publications55 total

Functional Interactions of Kluyveromyces lactis Telomerase Reverse Transcriptase with the Three-Way Junction and the Template Domains of Telomerase RNA
International Journal of Molecular Sciences·2022· 2 citedOpen Access
Pyrimidine motif triple helix in the <i>Kluyveromyces lactis</i> telomerase RNA pseudoknot is essential for function in vivo
Proceedings of the National Academy of Sciences·2013· 63 cited
197 Modeling the maturation pathway of the HIV-1 5’-UTR RNA dimer
Journal of Biomolecular Structure and Dynamics·2013
Binding Characteristics of Small Molecules That Mimic Nucleocapsid Protein-Induced Maturation of Stem-Loop 1 of HIV-1 RNA
Biochemistry·2010· 7 citedOpen Access
Sequence-dependent Kink-and-Slide Deformations of Nucleosomal DNA Facilitated by Histone Arginines Bound in the Minor Groove
Journal of Biomolecular Structure and Dynamics·2010· 48 cited
Determination of Three-Dimensional Structures of Nucleic Acids by NMR
Elsevier eBooks·2010· 1 cited
RNA structural motifs that entail hydrogen bonds involving sugar–phosphate backbone atoms of RNA
New Journal of Chemistry·2010· 34 citedOpen Access
Discovery of Ligands for a Novel Target, the Human Telomerase RNA, Based on Flexible-Target Virtual Screening and NMR
Journal of Medicinal Chemistry·2008· 39 citedOpen Access
Pseudoknot structures with conserved base triples in telomerase RNAs of ciliates
Nucleic Acids Research·2007· 47 citedOpen Access
Refinement of Nucleic Acid Structures with Residual Dipolar Coupling Restraints in Cartesian Coordinate Space
2007· 2 cited
Nucleocapsid protein-mediated maturation of dimer initiation complex of full-length SL1 stemloop of HIV-1: sequence effects and mechanism of RNA refolding
Nucleic Acids Research·2007· 33 citedOpen Access
A Triple Helix within a Pseudoknot Is a Conserved and Essential Element of Telomerase RNA
Molecular and Cellular Biology·2007· 91 citedOpen Access
Conformational Ensemble Calculations: Analysis of Protein and Nucleic Acid NMR Data
Kluwer Academic Publishers eBooks·2006· 1 cited
NMR Structure of the Full-length Linear Dimer of Stem-Loop-1 RNA in the HIV-1 Dimer Initiation Site
Journal of Biological Chemistry·2006· 51 citedOpen Access
Linear dimer of stemloop SL1 from HIV-1
2006
Characteristics of two-step RNA dimerization in avian sarcoma and leukosis viruses
Molecular Biology·2005· 3 cited
Solution Structure of a Consensus Stem-Loop D RNA Domain that Plays Important Roles in Regulating Translation and Replication in Enteroviruses and Rhinoviruses <sup>,</sup>
Biochemistry·2004· 52 cited
NMR Structures of Loop B RNAs from the Stem−Loop IV Domain of the <i>Enterovirus </i>Internal Ribosome Entry Site:  A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA<sup>,</sup>
Biochemistry·2004· 43 cited
Loop B RNAs from the Stem-Loop IV domain of the Enterovirus Internal Ribosome Entry Site with a Six-nucleotide Bulge AUCCCU
Biological Magnetic Resonance Bank·2004Open Access
NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE
2003
page 1 of 3Next →

Frequent Co-authors

Thomas Leroy James(27), Victor B. Zhurkin(6), Uli Schmitz(6), Zhihua Du(6), Anwer Mujeeb(5), Elvira E. Minyat(5), Shauna Farr-Jones(4), Yehuda Tzfati(4), T. L. James(4), V. I. Ivanov(4), He Liu(3), Stanley B. Prusiner(3), Fred E. Cohen(3), Kinneret Shefer(3), Yogev Brown(3), Tristram G. Parslow(3), Christophe Guilbert(3), Alessandro Donati(3), Artemy D. Beniaminov(3), Darlene Groth(2)